Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00025360
Genome
Streptococcus pneumoniae - NC_003098.1
TF
SczA [UniProtKB:Q8DNK2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GGACACTTAAGGCAAATTGTTCAGAACTGAATA - [1645609, 1645641] 17640279 Experimental technique details Beta-gal reporter assay - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 909

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... czcD spr1673
Gene Locus tag Description
czcD spr1672 cation efflux system protein
spr1673 spr1673 hypothetical protein