Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000251e0
Genome
Aliivibrio fischeri - NC_006840.2
TF
LuxR [UniProtKB:P35327, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AACTGTAAAATCGGACAGGT + [1287500, 1287519] 18083819 Experimental technique details Consensus search (ECO:0005624) - Experimental technique details GFP Promoter Fusion (ECO:0005636) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 897

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VF_1161 VF_1162 VF_1163 VF_1164 macB
Gene Locus tag Description
VF_1161 VF_1161 periplasmic protein of efflux system
VF_1162 VF_1162 outer membrane protein TolC
VF_1163 VF_1163 export ABC transporter permease
VF_1164 VF_1164 export ABC transporter permease
macB VF_1165 macrolide ABC transporter ATP-binding/membrane protein