Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00025180
Genome
Leptospira interrogans - NC_005823.1
TF
LexA [UniProtKB:Q72P22, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTGTAATTATACTTGTACAA + [3218510, 3218529] 24098496 Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 893

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... LIC12654 LIC12653
Gene Locus tag Description
LIC12654 LIC12654 LexA family transcriptional repressor
LIC12653 LIC12653 hypothetical protein