Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00024fc0
Genome
Vibrio vulnificus - NC_014966.1
TF
SmcR [UniProtKB:Q7ME71, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AATGATGTTAATGATAATTATT - [1410209, 1410230] 22696215 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Luciferase reporter assay (ECO:0005648) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 878

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VVMO6_04199 VVMO6_04198 VVMO6_04197 VVMO6_04200
Gene Locus tag Description
VVMO6_04199 VVMO6_04199 non-ribosomal peptide synthetase modules siderophore biosynthesis
VVMO6_04198 VVMO6_04198 non-ribosomal peptide synthetase modules siderophore biosynthesis
VVMO6_04197 VVMO6_04197 phosphopantetheinyl transferase component of siderophore synthetase
VVMO6_04200 VVMO6_04200 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase I alpha