Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000249f0
Genome
Escherichia coli - NC_000913.3
TF
ArcA [UniProtKB:P0A9Q1, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATGTTACGTAATTGTGTAAGT - [4337486, 4337506] 24146625 Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details ChIP-PCR (ECO:0005620) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details PSSM site search (ECO:0005659) - 871

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... adiY adiC eptA basR basS
Gene Locus tag Description
adiY b4116 DNA-binding transcriptional activator
adiC b4115 arginine:agmatine antiporter
eptA b4114 lipid A phosphoethanolamine transferase
basR b4113 DNA-binding response regulator in two-component regulatory system with BasS
basS b4112 sensory histidine kinase in two-component regulatory system with BasR