Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00024970
Genome
Escherichia coli - NC_000913.3
TF
ArcA [UniProtKB:P0A9Q1, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AAGTTAATTTAATGTTAAGTA - [1678199, 1678219] 24146625 Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details ChIP-PCR (ECO:0005620) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details PSSM site search (ECO:0005659) - 871

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... pntA pntB ydgH
Gene Locus tag Description
pntA b1603 pyridine nucleotide transhydrogenase, alpha subunit
pntB b1602 pyridine nucleotide transhydrogenase, beta subunit
ydgH b1604 predicted protein