Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00024920
Genome
Escherichia coli - NC_000913.3
TF
ArcA [UniProtKB:P0A9Q1, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TGGTTAAATTTATGTAATAAA + [4360276, 4360296] 24146625 Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details ChIP-PCR (ECO:0005620) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details PSSM site search (ECO:0005659) - 871

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... cadB cadA dtpC
Gene Locus tag Description
cadB b4132 predicted lysine/cadaverine transporter
cadA b4131 lysine decarboxylase, acid-inducible
dtpC b4130 dipeptide and tripeptide permease