Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00024900
Genome
Escherichia coli - NC_000913.3
TF
ArcA [UniProtKB:P0A9Q1, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATGTAAAAACCATGTTAAACA + [4196852, 4196872] 24146625 Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details ChIP-PCR (ECO:0005620) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details PSSM site search (ECO:0005659) - 871

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... rsd nudC hemE nfi yjaG
Gene Locus tag Description
rsd b3995 stationary phase protein, binds sigma 70 RNA polymerase subunit
nudC b3996 NADH pyrophosphatase
hemE b3997 uroporphyrinogen decarboxylase
nfi b3998 endonuclease V; deoxyinosine 3' endonuclease
yjaG b3999 conserved protein