Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000248e0
Genome
Escherichia coli - NC_000913.3
TF
ArcA [UniProtKB:P0A9Q1, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATGTAAAATTTATGTTACGTA - [4003184, 4003204] 24146625 Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details ChIP-PCR (ECO:0005620) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details PSSM site search (ECO:0005659) - 871

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... yigG yigF
Gene Locus tag Description
yigG b3818 conserved inner membrane protein
yigF b3817 predicted inner membrane protein