Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000248d0
Genome
Escherichia coli - NC_000913.3
TF
ArcA [UniProtKB:P0A9Q1, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CTGTTAAAACATTATTAAAAA - [3922834, 3922854] 24146625 Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details ChIP-PCR (ECO:0005620) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details PSSM site search (ECO:0005659) - 871

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... atpI atpB atpE atpF atpH atpA atpG atpD atpC
Gene Locus tag Description
atpI b3739 ATP synthase, membrane-bound accessory factor
atpB b3738 F0 sector of membrane-bound ATP synthase, subunit a
atpE b3737 F0 sector of membrane-bound ATP synthase, subunit c
atpF b3736 F0 sector of membrane-bound ATP synthase, subunit b
atpH b3735 F1 sector of membrane-bound ATP synthase, delta subunit
atpA b3734 F1 sector of membrane-bound ATP synthase, alpha subunit
atpG b3733 F1 sector of membrane-bound ATP synthase, gamma subunit
atpD b3732 F1 sector of membrane-bound ATP synthase, beta subunit
atpC b3731 F1 sector of membrane-bound ATP synthase, epsilon subunit