Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000247b0
Genome
Escherichia coli - NC_000913.3
TF
ArcA [UniProtKB:P0A9Q1, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTGTTAACGAATCATTAAATG - [2215591, 2215611] 24146625 Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details ChIP-PCR (ECO:0005620) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details PSSM site search (ECO:0005659) - 871

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... yohO mlrA yehU yehT yehS
Gene Locus tag Description
yohO b4542 predicted protein
mlrA b2127 DNA-binding transcriptional regulator
yehU b2126 predicted sensory kinase in two-component system with YehT, inner membrane protein
yehT b2125 predicted response regulator in two-component system withYehU
yehS b2124 conserved protein, DUF1456 family