Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000240b0
Genome
Bacillus subtilis - NC_000964.3
TF
CcpA [UniProtKB:P25144, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AGTAAAATGTAAGCATTTTCTTTTTGG - [2982363, 2982389] 12100558 Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Primer Extension assay (ECO:0005657) - Experimental technique details Visual sequence inspection (nan) - 858

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... citZ
Gene Locus tag Description
citZ BSU29140 citrate synthase