Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00023730
Genome
Streptococcus suis - NC_012925.1
TF
CcpA [UniProtKB:G5L2G2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTTTTTCAAGAAAATTTACAA + [1334375, 1334395] 24673665 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - 852

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... SSU1302 SSU1301 SSU1300 SSU1299 SSU1298 SSU1297
Gene Locus tag Description
SSU1302 SSU1302 metallo-beta-lactamase superfamily protein
SSU1301 SSU1301 esterase
SSU1300 SSU1300 protease
SSU1299 SSU1299 membrane protein
SSU1298 SSU1298 ABC transporter ATP-binding protein
SSU1297 SSU1297 hypothetical protein