Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000236e0
Genome
Streptococcus suis - NC_012925.1
TF
CcpA [UniProtKB:G5L2G2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GATTTTCAGAAAGATGTTCAA - [752199, 752219] 24673665 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - 852

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... SSU0718 SSU0719 SSU0720 tRNA-Tyr
Gene Locus tag Description
SSU0718 SSU0718 hypothetical protein
SSU0719 SSU0719 branched-chain amino acid aminotransferase
SSU0720 SSU0720 hypothetical protein
tRNA-Tyr SSUt66 tRNA