Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00023620
Genome
Streptococcus suis - NC_012925.1
TF
CcpA [UniProtKB:G5L2G2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTTTTTCATTTCATTTTTTCC + [978947, 978967] 24673665 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - 852

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... pstS pstC SSU0951 pstB2 pstB1 phoU
Gene Locus tag Description
pstS SSU0953 phosphate ABC transporter substrate-binding protein
pstC SSU0952 phosphate ABC transporter permease
SSU0951 SSU0951 phosphate ABC transporter permease
pstB2 SSU0950 phosphate transporter ATP-binding protein
pstB1 SSU0949 phosphate transporter ATP-binding protein
phoU SSU0948 phosphate transport system protein