Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00023610
Genome
Streptococcus suis - NC_012925.1
TF
CcpA [UniProtKB:G5L2G2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ACTTTTCTTTCAATTTTCCAA + [2005052, 2005072] 24673665 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - 852

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... htrA SSU1967 SSU1966 SSU1969
Gene Locus tag Description
htrA SSU1968 serine protease
SSU1967 SSU1967 rRNA large subunit methyltransferase
SSU1966 SSU1966 membrane protein
SSU1969 SSU1969 chromosome partitioning protein