Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000235b0
Genome
Streptococcus suis - NC_012925.1
TF
CcpA [UniProtKB:G5L2G2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTTTTTCCAAATTTTTCTCAC + [1679071, 1679091] 24673665 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - 852

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... SSU1665 oppA
Gene Locus tag Description
SSU1665 SSU1665 D-alanyl-D-alanine carboxypeptidase
oppA SSU1664 oligopeptide-binding protein OppA precursor