Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00023530
Genome
Streptococcus suis - NC_012925.1
TF
CcpA [UniProtKB:G5L2G2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GCTTTTCCGTAATATTTTAAA - [380116, 380136] 24673665 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - 852

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... SSU0355 SSU0356 SSU0357
Gene Locus tag Description
SSU0355 SSU0355 GntR family transcriptional regulator
SSU0356 SSU0356 endonuclease/exonuclease/phosphatase family protein
SSU0357 SSU0357 glucose-specific phosphotransferase system (PTS), IIABC component