Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00023470
Genome
Streptococcus suis - NC_012925.1
TF
CcpA [UniProtKB:G5L2G2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TATTCTCAAGCATTTTTTCAA - [1392936, 1392956] 24673665 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - 852

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... upp clpP SSU1365 SSU1364
Gene Locus tag Description
upp SSU1367 uracil phosphoribosyltransferase
clpP SSU1366 ATP-dependent Clp protease proteolytic subunit
SSU1365 SSU1365 hypothetical protein
SSU1364 SSU1364 branched-chain amino acid ABC transporter, amino acid-binding protein