Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000233d0
Genome
Streptococcus suis - NC_012925.1
TF
CcpA [UniProtKB:G5L2G2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GATTTTCAGTACATTTTTCAC + [1779303, 1779323] 24673665 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - 852

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... purA SSU1757 uppS SSU1755 eep gshA
Gene Locus tag Description
purA SSU1758 adenylosuccinate synthetase
SSU1757 SSU1757 preprotein translocase subunit
uppS SSU1756 UDP pyrophosphate synthase
SSU1755 SSU1755 phosphatidate cytidylyltransferase
eep SSU1754 pheromone-processing membrane metalloprotease
gshA SSU1759 bifunctional glutamate--cysteine ligase/glutathione synthetase