Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00023370
Genome
Streptococcus suis - NC_012925.1
TF
CcpA [UniProtKB:G5L2G2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AATTTTCAGAAAATTTCTTGA - [1698200, 1698220] 24673665 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - 852

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... alsS ilvH ilvC SSU1683 SSU1684 SSU1685
Gene Locus tag Description
alsS SSU1682 acetolactate synthase catalytic subunit
ilvH SSU1681 acetolactate synthase 3 regulatory subunit
ilvC SSU1680 ketol-acid reductoisomerase
SSU1683 SSU1683 glycosyl transferase
SSU1684 SSU1684 membrane protein
SSU1685 SSU1685 membrane protein