Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00023310
Genome
Streptococcus suis - NC_012925.1
TF
CcpA [UniProtKB:G5L2G2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CTTTTTCTATCCTTTTTTCAC - [10023, 10043] 24673665 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - 852

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... SSU0009 SSU0010 SSU0011 SSU0012 SSU0013 hpt ftsH
Gene Locus tag Description
SSU0009 SSU0009 S4 domain containing protein
SSU0010 SSU0010 septum formation initiator protein
SSU0011 SSU0011 hypothetical protein
SSU0012 SSU0012 hypothetical protein
SSU0013 SSU0013 PP-loop family protein
hpt SSU0014 hypoxanthine-guanine phosphoribosyltransferase
ftsH SSU0015 cell division protease FtsH