Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000231f0
Genome
Aliivibrio fischeri - NC_006840.2
TF
NsrR [UniProtKB:Q5E2D6, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTAATTAAAGGTGTATTTTAAATGCAACTTTAATTAA + [630305, 630341] 20487270 Experimental technique details Beta-gal reporter assay - Experimental technique details Site directed mutagenesis (ECO:0005667) - 844

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... aox VF_0577
Gene Locus tag Description
aox VF_0578 alternative oxidase 1
VF_0577 VF_0577 hypothetical protein