Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000230e0
Genome
Vibrio vulnificus - NC_014965.1
TF
AphA [UniProtKB:Q7MMB6, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CTATTCATAGGGATGAATAC - [2621953, 2621972] 24535746 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Primer Extension assay (ECO:0005657) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 835

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VVMO6_02440 VVMO6_02439 VVMO6_02438 VVMO6_02437 VVMO6_02436 VVMO6_02435 VVMO6_02434 VVMO6_02433
Gene Locus tag Description
VVMO6_02440 VVMO6_02440 iron-sulfur cluster regulator IscR
VVMO6_02439 VVMO6_02439 cysteine desulfurase IscS subfamily
VVMO6_02438 VVMO6_02438 iron-sulfur cluster assembly scaffold protein IscU
VVMO6_02437 VVMO6_02437 iron binding protein IscA for iron-sulfur cluster assembly
VVMO6_02436 VVMO6_02436 chaperone protein HscB
VVMO6_02435 VVMO6_02435 chaperone protein HscA
VVMO6_02434 VVMO6_02434 ferredoxin 2Fe-2S
VVMO6_02433 VVMO6_02433 hypothetical protein