Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00022e40
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
LasR [UniProtKB:P54292, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TCCTGTGAAATCTGGCAGTT - [3893269, 3893288] 24935161 Experimental technique details Beta-gal reporter assay - Experimental technique details Site directed mutagenesis (ECO:0005667) - 823

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... rhlA rhlB rhlR
Gene Locus tag Description
rhlA PA3479 rhamnosyltransferase chain A
rhlB PA3478 rhamnosyltransferase chain B
rhlR PA3477 transcriptional regulator RhlR