Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000222e0
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
PvdS [UniProtKB:G3XCV1, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TAATTTTCACGATGTGTCGTCCGT - [2687234, 2687257] 12207696 Experimental technique details Beta-gal reporter assay - Experimental technique details Consensus search (ECO:0005624) - Experimental technique details DNA-array expression analysis (ECO:0005525) - 801

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... PA2402 pvdJ pvdD PA2403 PA2404 PA2405 PA2406 PA2407 PA2408 PA2409 PA2410
Gene Locus tag Description
PA2402 PA2402 peptide synthase
pvdJ PA2400 protein PvdJ
pvdD PA2399 pyoverdine synthetase D
PA2403 PA2403 hypothetical protein
PA2404 PA2404 hypothetical protein
PA2405 PA2405 hypothetical protein
PA2406 PA2406 hypothetical protein
PA2407 PA2407 adhesion protein
PA2408 PA2408 ABC transporter ATP-binding protein
PA2409 PA2409 ABC transporter permease
PA2410 PA2410 hypothetical protein