Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000222c0
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
PvdS [UniProtKB:G3XCV1, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TAATTATTTGCCGTTGTTATCCGT - [2721664, 2721687] 12207696 Experimental technique details Beta-gal reporter assay - Experimental technique details Consensus search (ECO:0005624) - Experimental technique details DNA-array expression analysis (ECO:0005525) - 801

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... pvdG pvdL pvdS
Gene Locus tag Description
pvdG PA2425 protein PvdG
pvdL PA2424 peptide synthase
pvdS PA2426 extracytoplasmic-function sigma-70 factor