Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00022290
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
PvdS [UniProtKB:G3XCV1, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CAAATTTCCGCTGTGATCGTACGT - [2754496, 2754519] 12207696 Experimental technique details Beta-gal reporter assay - Experimental technique details Consensus search (ECO:0005624) - Experimental technique details DNA-array expression analysis (ECO:0005525) - 801

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... PA2452 PA2451 PA2453 PA2454 PA2455 PA2456
Gene Locus tag Description
PA2452 PA2452 hypothetical protein
PA2451 PA2451 hypothetical protein
PA2453 PA2453 hypothetical protein
PA2454 PA2454 hypothetical protein
PA2455 PA2455 hypothetical protein
PA2456 PA2456 hypothetical protein