Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00022230
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
TrpI [UniProtKB:P11720, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TATTCGTGAGTTTTCCTGACAGGTTGC - [39172, 39198] 2107533 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Hydroxyl-radical footprinting (ECO:0005643) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - 799

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... trpB trpA trpI PA0038
Gene Locus tag Description
trpB PA0036 tryptophan synthase subunit beta
trpA PA0035 tryptophan synthase subunit alpha
trpI PA0037 transcriptional regulator TrpI
PA0038 PA0038 hypothetical protein