Site information for: IscR in species Pseudomonas aeruginosa; genome accession: NC

Transcription Factor Binding Site Information

dbxref: CollecTF:EXPSITE_00021e70
Genome: Pseudomonas aeruginosa - NC_002516.2
TF: IscR [UniProtKB:Q9HXI7, view regulon]

Supporting Evidence

Binding site	Location	Publication	Experimental techniques used	Curation
AATCCTGAGTAATTTGATCGGTCTT	- [4272728, 4272752]	24466226	Experimental technique details qRT-PCR [RNA] (ECO:0001808) qRT-PCR [RNA] - ECO:0001808 Quantitative Reverse-Transcription PCR is a modification of PCR in which RNA is first reverse transcribed into cDNA and this is amplified measuring the product (qPCR) in real time. It therefore allows one to analyze transcription by directly measuring the product (RNA) of a gene's transcription. If the gene is transcribed more, the starting product for PCR is larger and the corresponding volume of amplification is also larger. - Experimental technique details Visual sequence inspection (nan) Visual sequence inspection - nan Visual inspection of promoter region to identify putative binding sites based on previous knowledge -	774

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Gene	Locus tag	Description
iscR	PA3815	IscR
iscS	PA3814	cysteine desulfurase
iscU	PA3813	scaffold protein
iscA	PA3812	iron-binding protein IscA
hscB	PA3811	co-chaperone HscB
hscA	PA3810	chaperone protein HscA
fdx2	PA3809	(2Fe-2S) ferredoxin
PA3808	PA3808	hypothetical protein