Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00021e50
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
ArgR [UniProtKB:G3XCU2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TGCTCCCGGGGTGAACGAATATGTCGCAGCACGGTAAGTGTT - [3441666, 3441707] 11133942 Experimental technique details Beta-gal reporter assay - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details Visual sequence inspection (nan) - 772

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... gdhB PA3067 PA3066 PA3065
Gene Locus tag Description
gdhB PA3068 NAD-dependent glutamate dehydrogenase
PA3067 PA3067 transcriptional regulator
PA3066 PA3066 hypothetical protein
PA3065 PA3065 hypothetical protein