Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00021e30
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
ArgR [UniProtKB:G3XCU2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TGACCGACGGCGGCACCTGCGTGTCGCAGAAACGAAA - [4322672, 4322708] 19850617 Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details Visual sequence inspection (nan) - 770

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... dauB dauA dauR
Gene Locus tag Description
dauB PA3862 NAD(P)H-dependent anabolic L-arginine dehydrogenase, DauB
dauA PA3863 FAD-dependent catabolic D-arginine dehydrogenase, DauA
dauR PA3864 transcriptional regulator