Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00021e20
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
ArgR [UniProtKB:G3XCU2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TGTCGCATCGCTGCAGTGCGCTGTCGCGTAGGAACAAAACTG - [5800369, 5800410] 15175299 Experimental technique details Beta-gal reporter assay - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - 769

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... PA5152 PA5153 PA5154 PA5155
Gene Locus tag Description
PA5152 PA5152 ABC transporter ATP-binding protein
PA5153 PA5153 amino acid ABC transporter substrate-binding protein
PA5154 PA5154 ABC transporter permease
PA5155 PA5155 amino acid (lysine/arginine/ornithine/histidine/octopine) ABC transporter membrane protein