Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00021dd0
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
ArgR [UniProtKB:G3XCU2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CGGCGAGAAAATGAAATTCAATGTCGCCAAAATGAAAGACGA + [5672266, 5672307] 15175299 Experimental technique details Beta-gal reporter assay - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - 769

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... gltB gltD
Gene Locus tag Description
gltB PA5036 glutamate synthase subunit alpha
gltD PA5035 glutamate synthase subunit beta