Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00021d50
Genome
Pseudomonas syringae group genomosp. 3 - NC_004578.1
TF
PvdS [UniProtKB:Q884G0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TAAATCACTGGAGGCACTCAAACGTTTAT + [2341777, 2341805] 18363796 Experimental technique details Luciferase reporter assay (ECO:0005648) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 765

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... PSPTO_2149 PSPTO_2148 PSPTO_2150
Gene Locus tag Description
PSPTO_2149 PSPTO_2149 pyoverdine sidechain peptide synthetase III, L-Thr-L-Ser component
PSPTO_2148 PSPTO_2148 pyoverdine sidechain peptide synthetase II, D-Asp-L-Thr component
PSPTO_2150 PSPTO_2150 pyoverdine sidechain peptide synthetase IV, D-Asp-L-Ser component