Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00021d40
Genome
Pseudomonas syringae group genomosp. 3 - NC_004578.1
TF
PvdS [UniProtKB:Q884G0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CTAAATTCCGGCCTGCATTTCTCGTTTAA - [2374176, 2374204] 18363796 Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 765

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... PSPTO_2160 PSPTO_2159 PSPTO_2158 PSPTO_2161
Gene Locus tag Description
PSPTO_2160 PSPTO_2160 RND family efflux transporter MFP subunit
PSPTO_2159 PSPTO_2159 macrolide ABC efflux protein
PSPTO_2158 PSPTO_2158 outer membrane efflux protein
PSPTO_2161 PSPTO_2161 penicillin amidase family protein