Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00021d10
Genome
Pseudomonas syringae group genomosp. 3 - NC_004578.1
TF
PvdS [UniProtKB:Q884G0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTGAATTAATTCTCCCGTCCGTCGTTCTC + [800053, 800081] 18363796 Experimental technique details Luciferase reporter assay (ECO:0005648) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 765

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... PSPTO_0753
Gene Locus tag Description
PSPTO_0753 PSPTO_0753 Bcr/CflA family multidrug resistance transporter