Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00021cb0
Genome
Pseudomonas syringae group genomosp. 3 - NC_004578.1
TF
PvdS [UniProtKB:Q884G0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CTAATTATTTGCAGACGCCATCCGTTCTC + [2306852, 2306880] 18363796 Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 765

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... PSPTO_2134 PSPTO_2133 pvsA daT PSPTO_2137
Gene Locus tag Description
PSPTO_2134 PSPTO_2134 pyoverdine synthetase, thioesterase component
PSPTO_2133 PSPTO_2133 RNA polymerase sigma-70 family protein
pvsA PSPTO_2135 pyoverdine chromophore precursor synthetase
daT PSPTO_2136 2,4-diaminobutyrate 4-transaminase
PSPTO_2137 PSPTO_2137 MbtH-like protein