Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00021c80
Genome
Pseudomonas syringae group genomosp. 3 - NC_004578.1
TF
PvdS [UniProtKB:Q884G0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTAATTACTGGCCCTCGCTAATCGTTCTT - [5573258, 5573286] 18363796 Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 765

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... azu PSPTO_4924
Gene Locus tag Description
azu PSPTO_4923 azurin
PSPTO_4924 PSPTO_4924 transglutaminase-like domain protein