Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00021c40
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
ArgR [UniProtKB:G3XCU2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CTTCGGTGCTTTTATAATTAGTTGTCGCATTGAAGAAATAACC + [971963, 972005] 9791103 Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - 762

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... aotJ aotQ aotM PA0891 aotP argR PA0887.1
Gene Locus tag Description
aotJ PA0888 arginine/ornithine binding protein AotJ
aotQ PA0889 arginine/ornithine transporter AotQ
aotM PA0890 arginine/ornithine transporter AotM
PA0891 PA0891 hypothetical protein
aotP PA0892 arginine/ornithine transporter AotP
argR PA0893 transcriptional regulator ArgR
PA0887.1 PA0887.1 ncRNA