Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00021bc0
Genome
Pseudomonas putida - NC_003350.1
TF
IHF [UniProtKB:P0A126, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTTTTTACAAAGAAAATCAATAATTTA - [75468, 75494] 11694511 Experimental technique details Beta-gal reporter assay - Experimental technique details UV footprinting - 757

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... xylA xylM xylC xylW xylU tnpA
Gene Locus tag Description
xylA pWWO_p094 xylA
xylM pWWO_p095 xylM
xylC pWWO_p096 xylC
xylW pWWO_p097 xylW
xylU pWWO_p098 xylU
tnpA pWWO_p099