Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00021a20
Genome
Pseudomonas putida - NC_002947.3
TF
OxyR [UniProtKB:Q88C74, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATAGCCAAAACCAATCGAAAGCATGAGCTTTGCCAAT + [2786878, 2786914] 17107553 Experimental technique details EMSA (ECO:0001807) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - Experimental technique details Visual sequence inspection (nan) - 740

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... ahpC PP_2438 ahpF PP_2441
Gene Locus tag Description
ahpC PP_2439 alkyl hydroperoxide reductase
PP_2438 PP_2438 hypothetical protein
ahpF PP_2440 alkyl hydroperoxide reductase
PP_2441 PP_2441 hypothetical protein