Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00021a10
Genome
Pseudomonas putida - NC_002947.3
TF
OxyR [UniProtKB:Q88C74, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ACAGAGCCAGCCTATCAGGCTCCAACAGCCACTCTAT - [4170108, 4170144] 17107553 Experimental technique details Ad-hoc quantitative phenotype observation (ECO:0005676) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - Experimental technique details Visual sequence inspection (nan) - 740

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... PP_3668 PP_3669
Gene Locus tag Description
PP_3668 PP_3668 catalase/peroxidase HPI
PP_3669 PP_3669 LysR family transcriptional regulator