Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00021860
Genome
Corynebacterium glutamicum - NC_006958.1
TF
ArgR [UniProtKB:O85175, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TCCGCGTACAGCTCTTAAAAAGAAACA + [1467826, 1467852] 21115700 Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 723

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... argB argJ argD argF argR
Gene Locus tag Description
argB cg1582 acetylglutamate kinase
argJ cg1581 bifunctional ornithine acetyltransferase/N-acetylglutamate synthase
argD cg1583 acetylornithine aminotransferase
argF cg1584 ornithine carbamoyltransferase
argR cg1585 arginine repressor ArgR