Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00021830
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
ArgR [UniProtKB:G3XCU2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CTGCGCCTTCCCGATGCTTTCTGTCGCATTTCCGAAAGCCGC + [977756, 977797] 9286981 Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details S1 nuclease protection (ECO:0005666) - 720

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... aruC PA0894
Gene Locus tag Description
aruC PA0895 bifunctional N-succinyldiaminopimelate-aminotransferase/acetylornithine transaminase protein
PA0894 PA0894 hypothetical protein