Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00021820
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
ArgR [UniProtKB:G3XCU2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AGGCGCGATCTTATAAGGAAATGTCGCGGAAACACAAGGAGG - [3958883, 3958924] 9286981 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - 720

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... argF PA3536 PA3538 PA3539
Gene Locus tag Description
argF PA3537 ornithine carbamoyltransferase
PA3536 PA3536 hypothetical protein
PA3538 PA3538 ABC transporter ATP-binding protein
PA3539 PA3539 hypothetical protein