Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00021810
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
ArgR [UniProtKB:G3XCU2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CGTCTTATTGGTGGACCGGAATGTCGCGATTCTGTAAACTAC - [5345029, 5345070] 9286981 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - 720

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... carA PA4758.1 PA4757 carB greA PA4754
Gene Locus tag Description
carA PA4758 carbamoyl phosphate synthase small subunit
PA4758.1 PA4758.1 ncRNA
PA4757 PA4757 leucine export protein LeuE
carB PA4756 carbamoyl phosphate synthase large subunit
greA PA4755 transcription elongation factor GreA
PA4754 PA4754 hypothetical protein