Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00021750
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
ArgR [UniProtKB:G3XCU2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TCGTCTTTCATTTTGGCGACATTGAATTTCATTTTCTCGCCG - [5672266, 5672307] 15175298 Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - 714

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... gltB gltD
Gene Locus tag Description
gltB PA5036 glutamate synthase subunit alpha
gltD PA5035 glutamate synthase subunit beta