Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00021660
Genome
Helicobacter pylori - NC_008086.1
TF
Fur [UniProtKB:Q1CU85, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AAGAAAAGATTTACCAAAAAGTATTAAAAAATGATTACAATAC + [1058473, 1058515] 19399190 Experimental technique details EMSA (ECO:0001807) - Experimental technique details RNAse protection (ECO:0000288) - Experimental technique details Visual sequence inspection (nan) - 703

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... HPAG1_1003 HPAG1_1002 HPAG1_1004
Gene Locus tag Description
HPAG1_1003 HPAG1_1003 iron-dependent superoxide dismutase
HPAG1_1002 HPAG1_1002 adhesin-thiol peroxidase
HPAG1_1004 HPAG1_1004 hypothetical protein