Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00021650
Genome
Helicobacter pylori - NC_000921.1
TF
Fur [UniProtKB:Q9ZM26, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AAGAAAAGATTTACCAAAAAGTGTTAAAAAATGATTACAATAG + [1102690, 1102732] 19399190 Experimental technique details EMSA (ECO:0001807) - Experimental technique details RNAse protection (ECO:0000288) - 702

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... sodF tpx jhp0993
Gene Locus tag Description
sodF jhp0992 iron-dependent superoxide dismutase
tpx jhp0991 thiol peroxidase
jhp0993 jhp0993 hypothetical protein